Review



clone a20  (Cytek Biosciences)


Bioz Verified Symbol Cytek Biosciences is a verified supplier
Bioz Manufacturer Symbol Cytek Biosciences manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Cytek Biosciences clone a20
    Clone A20, supplied by Cytek Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd45+1+a20/APC+Anti-Mouse+CD45%2E1/pm40930105-295-94-96
    Average 93 stars, based on 8 article reviews
    clone a20 - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: Non-conditioned bone marrow chimeric mouse generation using culture-based enrichment of hematopoietic stem and progenitor cells
    Article Snippet: .. Supplementary Table 1: Antibodies used in this study Antibody Dilutio n Source Identifier APC anti-c-Kit (2B8) 1:100 eBioscience Cat# 17-1171-83 PE anti-CD150 (SLAM) (TC1512F12.2) 1:350 BioLegend Cat# 115904 FITC anti-CD34 (RAM34) 1:100 eBioscience Cat# 11-0341-85 PE/Cy5 anti-CD34 (MEC14.7) 1:100 BioLegend Cat# 119312 PE/Cy7 anti- Ly-6A/E (Sca-1)(D7) 1:700 eBioscience Cat # 25-5981-82 PE anti-Ly-6A/E (Sca-1) (D7) 1:700 BioLegend Cat# 108108 APC-eFluor 780 Ly-6G/Ly-6C (RB68C5) 1:1400 eBioscience Cat# 47-5931-82 APC-eFluor 780 CD11b (M1/70) 1:1400 eBioscience Cat# 47-0112-82 APC-eFluor 780 CD4 (RM4-5) 1:1400 eBioscience Cat# 47-0042-82 APC-eFluor 780 CD8a (53-6.7) 1:700 eBioscience Cat# 47-0081-82 APC-eFluor 780 CD45R (B220) 1:700 eBioscience Cat# 47-0452-82 APC-eFluor 780 CD127 (A7R34) 1:350 eBioscience Cat# 47-1271-82 APC-eFluor 780 TER-119 (TER-119) 1:350 eBioscience Cat# 47-5921-82 PE-Cy7 anti-CD45.1(A20) 1:500 Tonbo Biosciences Cat# 60-0453-U025 eFluor450 anti-CD45.2 (104) 1:500 eBioscience Cat# 48-0454-82 PE anti-Ly-6G/Ly-6C (RB6-8C5) 1:2000 eBioscience Cat# 12-5931-82 PE anti-CD11b (M1/70) 1:2000 eBioscience Cat# 12-0112-82 APC-eFluor780 anti-CD45R (RA36B2) 1:1000 eBioscience Cat# 17-0452-83 APC anti-CD4 (RM4-5) 1:2000 BioLegend Cat# 100516 APC anti-CD8 (53-6.7) 1:2000 eBioscience Cat# 17-0081-83 Supplementary Table 2: Primers used in this study Primer name Primer sequence p16Ink4a forward GAACTCTTTCGGTCGTACCC p16Ink4a reverse CGAATCTGCACCGTAGTTGA p19Arf forward GGGTTTTCTTGGTGAAGTTCG p19Arf reverse TTGCCCATCATCATCACCT Trp53 forward CAGTCTACTTCCCGCCATAA Trp53 reverse GTCTCAGCCCTGAAGTCATAAG EGFP forward AAGTTCATCTGCACCACCG EGFP reverse TCCTTGAAGAAGATGGTGCG AE9a forward CCACCTACCACAGAGCCATCA AE9a reverse AGCCTAGATTGCGTCTTCACATC BCR-ABL forward CCGCTGACCATCAATAAGGAA BCR-ABL reverse CTGAGGCTCAAAGTCAGATGCTACT Gapdh forward AACTTTGGCATTGTGGAAGG Gapdh reverse ACACATTGGGGGTAGGAACA ..



    Similar Products

    96
    Thermo Fisher cd45 1 a20 pe cy7 thermo fisher ab 469629
    Cd45 1 A20 Pe Cy7 Thermo Fisher Ab 469629, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd45+1+a20/Sorvall+MTX+150/pmc10499021__Supplemental_Materials-254-81-84
    Average 96 stars, based on 1 article reviews
    cd45 1 a20 pe cy7 thermo fisher ab 469629 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Cytek Biosciences clone a20
    Clone A20, supplied by Cytek Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd45+1+a20/APC+Anti-Mouse+CD45%2E1/pm40930105-295-94-96
    Average 93 stars, based on 1 article reviews
    clone a20 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    fluidigm 3153002b
    3153002b, supplied by fluidigm, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd45+1+a20/Anti-Mouse+CD45%2E1+(A20)-153Eu/pmc12173932-28-9-7
    Average 93 stars, based on 1 article reviews
    3153002b - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    fluidigm a20
    A20, supplied by fluidigm, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd45+1+a20/Anti-Mouse+CD45%2E1+(A20)-153Eu/pmc12173932-28-5-7
    Average 93 stars, based on 1 article reviews
    a20 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Cytek Biosciences a20
    A20, supplied by Cytek Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd45+1+a20/PE-Cyanine7+Anti-Mouse+CD45%2E1/pmc12254332-37-2-4
    Average 93 stars, based on 1 article reviews
    a20 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Cytek Biosciences anti cd45 1 a20 tonbo 75 0453 u100
    Anti Cd45 1 A20 Tonbo 75 0453 U100, supplied by Cytek Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd45+1+a20/violetFluor+450+Anti-Mouse+CD45%2E1/pm40023156-227-25-27
    Average 93 stars, based on 1 article reviews
    anti cd45 1 a20 tonbo 75 0453 u100 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    95
    Cytek Biosciences 0451 cd45 1 a20 bd biosciences
    0451 Cd45 1 A20 Bd Biosciences, supplied by Cytek Biosciences, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd45+1+a20/FITC+Anti-Mouse+CD45/pm39436772-27-45-42
    Average 95 stars, based on 1 article reviews
    0451 cd45 1 a20 bd biosciences - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    93
    Cytek Biosciences cd45 1 a20 pe cy7
    Cd45 1 A20 Pe Cy7, supplied by Cytek Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd45+1+a20/PE-Cyanine7+Anti-Mouse+CD45%2E1/pmc11393282-57-19-59
    Average 93 stars, based on 1 article reviews
    cd45 1 a20 pe cy7 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Cytek Biosciences pe cy7 cd45 1 a20
    KEY RESOURCES TABLE
    Pe Cy7 Cd45 1 A20, supplied by Cytek Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cd45+1+a20/PE-Cyanine7+Anti-Mouse+CD45%2E1/pmc11330628-25-0-4
    Average 93 stars, based on 1 article reviews
    pe cy7 cd45 1 a20 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    KEY RESOURCES TABLE

    Journal: Cell reports

    Article Title: G2 arrest primes hematopoietic stem cells for megakaryopoiesis

    doi: 10.1016/j.celrep.2024.114388

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: PE-Cy7 CD45.1 (A20) , Tonbo , Cat# 60-0453-U100; RRID: AB_2621850.

    Techniques: Recombinant, Adhesive, Purification, Blocking Assay, Amplification, Random Hexamer, Reverse Transcription, SYBR Green Assay, Sterility, Imaging, Software